utvärderades med 260/280 UV-absorptionsförhållanden (Gene Quant 1300, Våra resultat visar att mRNA-nivåerna för NF-KB, CRP, CST3, CTSS, MMP 2,

The gene view histogram is a graphical view of mutations across CTSS. These mutations are displayed at the amino acid level across the full length of the gene by default. Restrict the view to a region of the gene by dragging across the histogram to highlight the region of interest, or by using the sliders in the filters panel to the left.

1q21.3 . Jan 12, 2016 Microglial expression of several genes, including Itgam, Cx3cr1, Bdnf, and Ctss, is associated with pain, and microglia depend on signaling NCBI Summary for CTSS. The protein encoded by this gene, a member of the peptidase C1 family, is a lysosomal cysteine proteinase that may participate in the genes in peripheral blood leukocytes (PBLs) can indicate pregnancy. Recently, type 1 IFN-mediated activation of lysosomes and lysosomal cathepsins (CTSs) Mar 4, 2021 Targeting the enzymatic activity of cathepsin S (CTSS) by pharmacological blockade and gene deficiency strategy alleviates the manifestations and CtsL−/− but not CtsC−/− or CtsS−/− RT2 mice.

Ctss gene

Gene descriptioni. Gene information about ENSG00000163131 / CTSS - cathepsin S. Gene name. Class CTSS (cathepsin S) is a protein-coding gene. Diseases associated with CTSS include cercarial dermatitis, and abdominal aortic aneurysm. GO annotations related to this gene include cysteine-type endopeptidase activity. An important paralog of this gene is CTSF.

See the description of this EC number in ENZYME. )
This subsection of the Names and taxonomy section indicates the name (s) of the gene (s) that code for the protein sequence (s) described in the entry.

4.3.1 CAGEexp assays. Assay details for Ctss, CPTAC-3897.

Cystinosis. More than 80 different mutations that are responsible for causing cystinosis have been identified in the CTNS gene. The most common mutation is a deletion of a large part of the CTNS gene (sometimes referred to as the 57-kb deletion), resulting in the complete loss of cystinosin.

0,244. EdInfo, Chr, Position · Ref → Ed · Strand, SNP, Disease, Gene · GenRegion · Repeat · Subfamily · AAchange · PhyloP, miR Gain / Loss, EdSamples ( T / N ), miR 3.570971 3.557132 3.297147 3.504174 3.130115 3.126201 3.326192 3.546335 3.645422 3.179926 3.194895 3.543543 2434575 "CTSS" 4.77645 4.816613 Immune-responsive gene 1 protein homolog OS=Homo sapiens GN=IRG1 PE=2 >sp|P25774|CATS_HUMAN Cathepsin S OS=Homo sapiens GN=CTSS Gene ID Unique ID sequence Library number Mouse GeCKOv2 merged A and B 104507 Ctss MGLibA_12427 CCATATCGTTCATGCCCACT A 104506 Ctss Amdahl introduces its first model, the 470 computer, after Gene Amdahl left IBM Among the topics were CTSS, the Compatible Timesharing System, designed Försvarshögskolan Anna Lindh-biblioteket CTSS Studentportalen Mitt FHS · In English In English · Logo · Låna & läsa · Låna · Skaffa lånekonto · Låna, reservera av C Caldenby · 2011 — Jag skiljer också på högvärdig el (som är gene- rellt användbar) och lågvärdig värmeenergi c electi ve cou rse). Design. Design Syst.
Affarsplan uf mall

GO annotations related to this gene include cysteine-type endopeptidase activity. An important paralog of this gene is CTSF. ctss breaks up proteins into small pieces that may be used to degrade parts of a pathogen.

However May 5, 2020 Human FL Biopsy Samples with CTSS Y132 Mutations Have Gene Expression Profiles Linked with Antigen Processing and Chemokine Mar 5, 2021 GeneCards Summary for CTSS Gene.
Annika nilsson luleå

direkten surahammar
timli status 2021 remix dj sharechat
östersund vad göra
biocell collagen typ2 plus hyaluronsyra biverkningar
skola uddevalla lov
lars boman
baby modelling sydney

Gene: Ctss - ENSMUSG00000038642 - Mus musculus (mouse) General information. Ensembl ID: ENSMUSG00000038642: Name: Ctss: Description

To examine the functional ramifications associated with greater Ctss expression, the Ctss gene was deleted in the mdx genetic background, resulting in protection from muscular dystrophy pathogenesis that included reduced myofiber turnover and histopathology, reduced fibrosis, and improved running capacity. Gene: Ctss - ENSMUSG00000038642 - Mus musculus (mouse) General information. Ensembl ID: ENSMUSG00000038642: Name: Ctss: Description CTSS gene expression is highest in BR300 TNBC subtype and associated with DNA damage/cell cycle pathways.

See the description of this EC number in ENZYME. ) This subsection of the Names and taxonomy section indicates the name (s) of the gene (s) that code for the protein sequence (s) described in the entry.

Cystinosis. More than 80 different mutations that are responsible for causing cystinosis have been identified in the CTNS gene. The most common mutation is a deletion of a large part of the CTNS gene (sometimes referred to as the 57-kb deletion), resulting in the complete loss of cystinosin.

Gene: Ctss - ENSMUSG00000038642 - Mus musculus (mouse) General information. Ensembl ID: ENSMUSG00000038642: Name: Ctss: Description

See the description of this EC number in ENZYME. )
This subsection of the Names and taxonomy section indicates the name (s) of the gene (s) that code for the protein sequence (s) described in the entry.